rs729985 chr8:11656224 T>G
- Sequence
agagccttgttcattggtgagcac[T/G]ggatatcttttttatggtaaaaaa
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | n/a | 2.02 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1