rs730105 chr14:36605068 C>T
- Sequence
caggtttcttcctgaagggtttgt[C/T]cagtttccctagaaagcaaaacga
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.84 | n/a | 2.00 | |||
| A549 (lung carcinoma) | 0.23 | 1.21 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.40 | 0.88 | 1.60 | |||
| HepG2 (hepatoblastoma) | 0.68 | 0.17 | 1.94 | |||
| epidermal keratinocytes | 2.13 | -1.40 | 2.00 |
Items per page:
1 – 5 of 5