rs7301141 chr12:132561917 A>G
- Sequence
ctgtgtgaggggcccagatttggg[A/G]gcctggcccaagggagcacttggt
- ASB in cell types
- keratinocytes GM02630 (Fanconi anemi) neural cell
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.77 | -4.84 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cortex, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Spleen