rs7301790 chr12:43338134 C>T
- Sequence
acaggtaatcttcatgccagtgaa[C/T]gattacaccggaaacattggtgca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -2.00 | 2.37 | 1.00 | n/a | No Hit | |||
| STAG1_HUMAN | 0.30 | 1.50 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, parkinsons disease, triglycerides