rs730224 chr6:100228686 G>A
- Sequence
gtagaatggggcttttcacacaaa[G/A]gagtaacacaaaggaatagatctg
- ASB in cell types
- K562 (myelogenous leukemia) GM10847 (female B-cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.70 | 0.17 | 2.01 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 2.33 | -2.17 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -2.35 | 1.42 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, birth weight, ldl cholesterol, total cholesterol, triglycerides change with statins