rs7302456 chr12:62603863 G>T
- Sequence
ggggacagcccgcgaagcctcggc[G/T]cccggccggcgcggccaccacgga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.96 | 0.69 | 1.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach