rs7302685 chr12:52580514 G>A
- Sequence
ggattcatttttgaaagacaacag[G/A]gaggctgggggaaatgccttaatc
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.89 | -1.69 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood