rs7303746 chr12:19739166 G>C
- Sequence
cttttcgatatggtaaatattgta[G/C]gatatatttaaattaagtacttat
- ASB in cell types
- pancreas foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | -0.03 | 2.16 | 1.00 | |||
| foreskin keratinocyte | -0.45 | 1.62 | 2.00 |
Items per page:
1 – 2 of 2