rs7304904 chr12:108731719 G>T
- Sequence
ctggtcgcaccgagggatgcaggc[G/T]gtgcccaagcgcacgccccgctct
- ASB in cell types
- foreskin keratinocyte epidermal keratinocytes HMF (human mammary fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.49 | n/a | 2.83 | |||
| epidermal keratinocytes | 2.37 | -4.60 | 2.00 | |||
| HMF (human mammary fibroblasts) | 2.35 | -1.88 | 1.00 |
Items per page:
1 – 3 of 3