rs7305124 chr12:44822047 T>A
- Sequence
cccaaatttctgggattacaggca[T/A]gagccaccgcatctggcaaaaatt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN426_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN426_HUMAN | 2.32 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis