rs7305363 chr12:76511229 C>G
- Sequence
tcacatgcatgtgtctttatggta[C/G]agtgatttatattcctctgggtat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.19 | 0.79 | 1.11 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Whole_Blood