rs7305372 chr12:11498900 G>A
- Sequence
ccgtgtatcagagtgcagttctca[G/A]cctgaagaatgggaaatggaaagg
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.15 | -2.02 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.00 | 2.11 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -2.45 | 2.04 | 1.00 |
Items per page:
1 – 3 of 3