rs730551 chr6:6971520 C>T
- Sequence
cccagaagctgtggctccctcgca[C/T]gaccctggtttcgacagtgggtta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NR2C1_HUMAN MTG16_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | n/a | 2.15 | 3.00 | 3.23 | Concordant | |||
| MTG16_HUMAN | n/a | 2.47 | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP autism with verbal ability, hdl cholesterol, hip bone mineral density (bmd), triglycerides, years of education