rs7305621 chr12:90854170 G>A
- Sequence
gcaaagtaaactcaaatgtttgga[G/A]actgcatcgcccagacccatcacc
- ASB in cell types
- PC9 (lung adenocarcinoma) OCI-LY7 (diffuse large B-cell lymphoma) MCF7L-P(immortalized breast epithelial cell line) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -0.85 | 2.35 | 2.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.40 | -1.01 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 1.72 | -0.19 | 3.00 | |||
| neural cell | -0.17 | 0.93 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), biploar disorder (bipolar schizoaffective disorder), body mass index (bmi), hdl cholesterol, hdl cholesterol change with statins, total cholesterol, waist circumference in type 2 diabetes, waist hip ratio in type 2 diabetes