rs7305656 chr12:130916260 A>C
- Sequence
gtagggcgcctgactgtctaatgc[A/C]cctccgcatccccggcacgcagga
- ASB in cell types
- T47D (invasive ductal carcinoma) 2588 (Lymphoblastoid Cell Lines) macrophages Kasumi-1 (acute myeloblastic leukemia)
- ASB for transcription factors
- RAD21_HUMAN CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.76 | -0.30 | 1.50 | n/a | n/a | |||
| CEBPA_HUMAN | 1.93 | -1.59 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Stomach, Thyroid