rs7306171 chr12:65632267 G>C
- Sequence
aatcactcatgcaggtggcattat[G/C]tagagtctcaactaggctaactct
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) HEK293 (embryonic kidney) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- TCF21_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | n/a | 1.35 | 3.00 | n/a | No Hit | |||
| SMRC1_HUMAN | 0.62 | 2.05 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2