rs7307754 chr12:442729 C>T
- Sequence
acgcagctcagtttacgttcttgt[C/T]ccatggcctctgcagttttgtgca
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) RWPE2 foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.58 | -2.24 | 1.00 | |||
| RWPE2 | n/a | 3.27 | 2.00 | |||
| foreskin keratinocyte | 1.70 | -0.34 | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Heart_Atrial_Appendage, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood