rs7308093 chr12:54215128 C>T
- Sequence
gttctggggaccacccctcgcatt[C/T]ttgggttccctctctggcatctga
- ASB in cell types
- K562 (myelogenous leukemia) PC9 (lung adenocarcinoma) ascending aorta
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | 0.13 | 2.00 | |||
| PC9 (lung adenocarcinoma) | -0.18 | 1.55 | 2.00 | |||
| ascending aorta | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid