rs7308421 chr12:52583300 T>C
- Sequence
gaatggacccagtgccctccacct[T/C]tcacttagcccatctcggccaggt
- ASB in cell types
- erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 1.98 | -1.98 | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), schizophrenia
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood