rs7308990 chr12:52870908 C>T
- Sequence
caaagcaggaatatctgggggctc[C/T]aggccatcagcaacaccatccaga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 2.00 | -1.80 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting blood glucose, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio