rs7309332 chr12:7938243 T>C
- Sequence
cccagtggtgaattggagaaagtg[T/C]atcttcctttagggttttggttga
- ASB in cell types
- SK-N-SH (neuroblastoma) neural progenitors IPSC-derived bipolar neuron GM10847 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.50 | 3.06 | 1.48 | n/a | No Hit | |||
| SMCA4_HUMAN | -1.46 | 1.85 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2