rs7309909 chr12:94603580 G>A
- Sequence
aaaatgtgatggtgtatgattagc[G/A]tgctgcggaggtgagaagagtggt
- ASB in cell types
- neutrophils from periferal blood foreskin keratinocyte upper lobe of left lung PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.98 | -4.93 | 1.50 | |||
| foreskin keratinocyte | n/a | 0.56 | 2.67 | |||
| upper lobe of left lung | 1.55 | -0.39 | 1.00 | |||
| PC9 (lung adenocarcinoma) | -0.65 | 1.36 | 2.00 |
Items per page:
1 – 4 of 4