rs7310349 chr12:80868779 A>G
- Sequence
gctaagctttaattaactgaagat[A/G]aactatgtagcagataagatcact
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.75 | 0.16 | 1.72 | |||
| breast tumor | 2.21 | -1.47 | 2.00 |
Items per page:
1 – 2 of 2