rs7310771 chr12:53566405 A>G
- Sequence
cctcactataaaggctgaaaagca[A/G]gatattcctttttcctatgcagct
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.88 | -1.26 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, hip bone mineral density (bmd), ldl cholesterol, premature ovarian failure, schizophrenia, spine bone mineral density (bmd), total cholesterol, years of education
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Uterus