rs7310821 chr12:121129382 C>T
- Sequence
aataggttctcatgaggttgggca[C/T]atttcctgcacttgcagtctgtga
- ASB in cell types
- MDM(monocyte derived macrophages) GM02630 (Fanconi anemi) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- SPI1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.12 | -5.52 | 2.17 | n/a | No Hit | |||
| STAG1_HUMAN | 2.14 | 0.77 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2