rs7311238 chr12:53626708 G>A
- Sequence
taaaatacccttagcgctagaaat[G/A]aagtccatgtacggacaaagcaat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.46 | -4.69 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), college completion, fasting blood glucose, hdl cholesterol change with statins, ldl cholesterol, maternal transmission distortion, personality disorders (pd) - cluster b, total cholesterol, transmission distortion, years of education
GTEx eQTL Artery_Aorta, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Uterus