rs7311363 chr12:12398677 T>C
- Sequence
agtgctatcaaactcaaaatatgg[T/C]cattttaatgagaatttccaaaca
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.96 | -1.07 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.76 | 0.08 | 2.02 |
Items per page:
1 – 2 of 2