rs7313204 chr12:89702019 A>G
- Sequence
cattttgtgttgtatgtgaacagc[A/G]tcccctggagttgtgcaaagcagt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM19240 (B cells Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.98 | 2.61 | 1.48 | 2.97 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
