rs731360 chr1:193589751 C>G
- Sequence
gaatctctggcattgagcctactt[C/G]ggaaatcatgggagaggcaataga
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) | 1.39 | 0.23 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), lp-pla2 activity, major depressive disorder