rs731453 chr2:9984528 G>T
- Sequence
acactgggttcctcttaagtagca[G/T]cttccaatgtcatattcataatgt
- ASB in cell types
- KMS-11 (Plasma cell myeloma) K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- LMBL2_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMBL2_HUMAN | 2.79 | n/a | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.55 | 0.74 | 1.26 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, birth weight, diastolic blood pressure (dbp), major depressive disorder, neuroblastoma (brain cancer), serum creatinine
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid