rs7314747 chr12:26790237 A>T
- Sequence
ctgtcatccactaacctagaagga[A/T]aagcatgtttacattgttaacatc
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 2.17 | -0.69 | 1.50 | |||
| breast tumor | 1.68 | 0.84 | 2.00 |
Items per page:
1 – 2 of 2