rs7315008 chr12:89406176 A>T
- Sequence
agttgcaaaggaggcagggaagtg[A/T]gtgtctggcaaagggaaataggat
- ASB in cell types
- monocyte-derived dendritic cells macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.57 | 0.24 | 1.25 | -0.09 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
