rs731545 chr22:23752289 T>G
- Sequence
cacctgccttcagcaccctcagcc[T/G]tggcgctcgagtgcctccaatgct
- ASB in cell types
- germinal center CD77+ B cells
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | 2.83 | -0.20 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic