rs7315916 - ADASTRA v6.1.1

rs7315916 chr12:130761827 G>A

Sequence: aattgctagattgggcagaacccc[G/A]ctagagcccatccagttgcagaca
ASB in cell types: GM02610 (Lymphoblastoid Cell Lines) foreskin keratinocyte GM12891 (male B- cells lymphoblastoid cell line) SEM (childhood B acute lymphoblastic leukemia)
: Search SNPs nearby
View in UCSC Genome Browser
View in PheLiGe
0.05
FDR threshold
0
ES threshold

Color scale

-log10 FDR of Ref (G) ASB

-log10 FDR of Alt (A) ASB

Details

Transcription factors

Cell types

Cell type	Effect size Ref	Effect size Alt	FDR Ref	FDR Alt	Mean BAD
GM02610 (Lymphoblastoid Cell Lines)	0.71	n/a	3.9·10^-3	1.00	1.50
foreskin keratinocyte	0.53	n/a	0.01	1.00	2.67
GM12891 (male B- cells lymphoblastoid cell line)	0.96	-0.15	0.01	1.00	1.39
SEM (childhood B acute lymphoblastic leukemia)	2.52	n/a	0.02	1.00	1.33
2588 (Lymphoblastoid Cell Lines)	0.13	0.96	1.00	0.03	1.00

Items per page:

1 – 5 of 7

Motif analysis

No data available

Genetic associations

GRASP body mass index (bmi), hypertension (early onset hypertension), mitral annular calcium

GTEx eQTL Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid