rs7318092 chr13:54614145 G>T
- Sequence
ctttcctaggatgttttatcccca[G/T]ttaatctgttgatttgcttcttgg
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 0.88 | 0.43 | 1.31 | -0.50 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, partial epilepsy, stabilized warfarin dose, triglycerides