rs7318819 chr13:23845995 A>G
- Sequence
gtggcatgatctcagctcactgca[A/G]cctccacctgctgggttcaagcga
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.47 | 1.69 | 1.08 | n/a | n/a | |||
| CTCF_HUMAN | -0.68 | 1.64 | 1.13 | -0.29 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
