rs7319027 chr13:29363328 A>G
- Sequence
ttatacttattcagtatttttcat[A/G]tctattcttgtcttctttgttaac
- ASB in cell types
- foreskin keratinocyte right lobe of liver GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.92 | n/a | 3.00 | |||
| right lobe of liver | 2.14 | -1.81 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | -1.17 | 1.17 | 1.00 |
Items per page:
1 – 3 of 3