rs7321187 chr13:35630679 A>G
- Sequence
ccccttgcccacttcctcaaccct[A/G]taattctgtgtcagttcttagaac
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.71 | -1.44 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.44 | -1.25 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, arthritis including non-rheumatoid, asthma, hip bone mineral density (bmd), premature ovarian failure, salmonella-induced pyroptosis, years of education