rs7321748 chr13:75788603 T>C
- Sequence
accagatgcagtccatatactttt[T/C]cttcctgtgactgctcatgaaatc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) primary endothelial colony-forming cells
- ASB for transcription factors
- NOTC1_HUMAN TAL1_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | -4.84 | 2.74 | 2.00 | n/a | n/a | |||
| TAL1_HUMAN | -1.96 | 2.42 | 1.50 | 1.28 | Weak Concordant | |||
| SUH_HUMAN | -1.79 | 2.73 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP atopic dermatitis, barnes akathisia rating scale, chronic kidney disease, diastolic blood pressure (dbp), obesity with early age of onset (age >2), simpson-angus scale, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid