rs732236 chr5:127957297 T>C
- Sequence
gctccaggtgtgactcatcctgtc[T/C]ggtcctgggcagagacaaagtgtg
- ASB in cell types
- LHSAR (prostate epithelial cells) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | -0.13 | 1.04 | 1.50 | |||
| SK-N-SH (neuroblastoma) | 0.25 | 1.14 | 1.05 |
Items per page:
1 – 2 of 2