rs732410 chr3:127227496 G>A
- Sequence
gaagctgatggggtcaatccagcc[G/A]tctgtttaatcccagcaacaaagg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | -0.24 | 0.97 | 1.00 |
Items per page:
1 – 1 of 1