rs732523 chr12:47207060 C>T
- Sequence
ttgaatgggattttagcaaacaat[C/T]agatgttaccaaaatcttattagg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.09 | 0.68 | 2.00 |
Items per page:
1 – 1 of 1