rs732694 chr3:64187016 C>G
- Sequence
actgtaaaggttggagatacctgt[C/G]ttgaaagctagaactccaatggca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) SMMC-7721 (hepatocellular carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.21 | n/a | 6.00 | |||
| SMMC-7721 (hepatocellular carcinoma) | -1.86 | 2.66 | 2.00 |
Items per page:
1 – 2 of 2