rs73279388 chr8:69711551 C>A
- Sequence
gaagatgcaccaagcccaggcacc[C/A]gaggcccgaggtgccagccgtaga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | n/a | 2.59 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.36 | -4.24 | 1.50 |
Items per page:
1 – 2 of 2