rs732835 chr6:1392765 G>C
- Sequence
tctggatacattactgtcttggag[G/C]gggtgaaaactgcccagcaaagca
- ASB in cell types
- Hep 3B2.1-7 (HEP-3B, Hepatocellular carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Hep 3B2.1-7 (HEP-3B, Hepatocellular carcinoma) | 0.07 | 1.78 | 1.00 |
Items per page:
1 – 1 of 1