rs7328481 chr13:99617286 G>A
- Sequence
actcacagttcacgctaaaaattg[G/A]cacttttttttttcctaataaggg
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 1.96 | -1.34 | 1.33 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -1.59 | 2.07 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid