rs7331212 chr13:40611172 G>A
- Sequence
agcaatatattctcagaacaatga[G/A]ttttgttctaccctgttacataaa
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.20 | -0.60 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid