rs7331250 chr13:90867538 G>A
- Sequence
caggggaaataatggtgctcaaag[G/A]cctgaaatggaagctaatggtcac
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.68 | n/a | 2.00 | |||
| K562 (myelogenous leukemia) | 0.47 | 1.49 | 4.73 | |||
| 22RV1 (prostate carcinoma) | 2.37 | -0.13 | 2.00 |
Items per page:
1 – 3 of 3