rs733128 chr19:38033972 T>G
- Sequence
cccgctcactgcagcttgattgaa[T/G]gagggcttatttctcgctcacaac
- ASB in cell types
- germinal center CD77+ B cells ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center CD77+ B cells | 2.48 | n/a | 2.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 2 of 2