rs7333011 chr13:113562577 T>C
- Sequence
tggtcccgcaatgagctctgtggc[T/C]gccagatgcacctcccctccaagg
- ASB in cell types
- HEK293 (embryonic kidney) glioblastoma cells HeLa (cervical adenocarcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.11 | 1.16 | 2.17 | |||
| glioblastoma cells | 0.98 | 0.79 | 1.50 | |||
| HeLa (cervical adenocarcinoma) | n/a | 1.89 | 3.00 | |||
| foreskin keratinocyte | n/a | 0.60 | 2.67 | |||
| pancreas | -0.43 | 1.10 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid